Dataset: BATS_Feb_Aug_2012_diversity_rDNA_BLAST

Oceanographic sampling:  Water was collected with Niskin bottles mounted on a CTD rosette with integrated chlorophyll a fluorometer. Samples were collected from the mixed layer, chlorophyll max and mesopelagic. 200 L of seawater was passed through a 20 mm nytex mesh into 50L carboys cleaned with 0.1% bleach and distilled water.  The 20 mm-filtered seawater was serially filtered through 3.0, 0.8, and 0.1 mm filters (Millipore), with rapid transfer of filters to storage buffer and -80oC as described in Rusch et al. (2007).  Nucleic acids were extracted as previously described (Rusch et al 2007).

16S/18S small subunit ribosomal rDNA transcript sequencing: Approximately 500 bp of the v3v5 region of 16S rDNA gene was amplified using the nearly universal eubacterial primers 341F (5’-CCTACGGGNGGCWGCAG-3’) (Lane et al., 1985) and 926R (5’-CCGTCAATTCMTTTRAGT-3’) (Herlemann et al., 2011). Approximately 500 bp of the v4 region of the eukaryotic 18S rDNA transcript was amplified with the nearly universal primers TAReuk454FWD1 (5′-CCAGCASCYGCGGTAATTCC-3′) and TAReukREV3 (5′-ACTTTCGTTCTTGATYRA-3′) (Stoek et al., 2010). Primers were adapted for 454 sequencing by addition of FLX Titanium adapters (A adapter sequence: 5′ CCATCTCATCCCTGCGTGTCTCCGACTCAG 3′; B adapter sequence: 5′ CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3′) and incorporation of 10bp multiplex identifier (MID) barcodes to facilitate multiplexing.

Life Technologies AccuPrime PCR system was used to amplify the DNA. 1 µl of each sample (35-100 ng) was used in a 20 µl PCR reaction, which contained 1X AccuPrime Buffer II, .75 units of AccuPrime Taq High Fidelity, and a final primer concentration of 200 nM. A no template negative control for cDNA synthesis was used as a negative control for subsequent PCRs reactions. Cycling conditions included an initial denaturation at 95°C for 2 minutes, 30 cycles of 95°C for 20 seconds, 56°C for 30 seconds, 72°C for 5 minutes using a Life Technologies ProFlex PCR system. 2 µl of the samples and 5 µL of the negative control were run on a 1% agarose gel at 105 V for 35 minutes. Reactions were cleaned using Ampure XP beads (Beckman Coulter, Brea CA). The final products were resuspended in 25 µL of Qiagen elution buffer and 2.5 µL was uses for visualization on an agarose gel. 1 µL was used to quantify the final product using LifeTechnologies’ PicoGreen Quant-IT assay. 20 ng and 30 ng of each 16S or 18S amplicon respectively were pooled separately for sequencing.  

Library QC, emPCR, enrichment and 454 sequencing were performed by following the vendor’s standard protocols (Roche Diagnostics) with some modifications.  Specifically, qPCR was used to accurately estimate the number of molecules needed for emPCR using KAPA Biosystems Library Quantification Kit. Automation (BioMek FX) was used to “break” the emulsions after emPCR and butanol was used to enable easier sample handling during the breaking process. The REM e (Robotic Enrichment Module) from Roche was used to automate the bead enrichment process in the pipeline. Generally, between 10,000 and 40,000 16S and 18S sequences were recovered and analyzed for each of the samples.]  

References:

Herlemann D P R, Labrenz M, Jürgens K, Bertilsson S, Waniek J J, Andersson A F (2011) Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. The ISME J  5: 1571-1579

Lane D J, Pace B, Olsen G J, Stahl D A, Sogin M  L, Pace N R (1985) Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc of the Nat Acad of Sci USA.  82: 6955-6959

Stoeck T, Bass D, Nebel M, Christen, R, Jones M D M, Breiner H W, Richards T A. (2010). Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Molecular Ecology 19: 21-31.

Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, Yooseph S et al (2007). The Sorcerer II global ocean sampling expedition: Northwest Atlantic through Eastern Tropical Pacific. PloS Biology 5: 398-431.