Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

Primers Used:

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

Primers used from the following publications:
Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set

Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea

qPCR.csv