16S rRNA Gene Tag Sequencing (extracted from Hatzenpichler et. al., 2016)

Sediment DNA was extracted using the Power Soil DNA Isolation Kit according to the manufacturer’s protocol (MoBio), and diluted DNA from genomeamplified sorted consortia was used directly. The V4 region of the 16S rRNA gene was amplified from each extract using archaeal and bacterial primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) (67, 68). Sediment samples were amplified in duplicate. The nonbarcoded primers were used with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s directions, using annealing conditions of 54 °C for 30 cycles and 58 °C for 32 cycles for sediments and MDAs, respectively. Duplicates of sediment sample amplifications were then pooled. The barcoded 806R primer (CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT) was paired with 515F in a reconditioning reaction (same conditions as above except for five cycles of PCR) to barcode the PCR products. Samples were mixed together in equimolar amounts and purified in bulk through a Qiagen PCR purification kit before submission to Laragen for analysis on an Illumnia MiSeq platform. The resulting paired-end sequence data, 2× 250 bp, was demultiplexed, and sequences with >1 bp mismatch on the 12-bp barcode were removed. The resulting sequences were passed through Illumina’s MiSeq Recorder software to assign quality scores to each base call and remove adapter, barcode, and primer sequence.

Information on the fluorescence activiated cell sorted microbial aggregate composed of ANME and SRB, and other probe information can be found in Hatzenpichler et. al., 2016

Data Manager Notes:

several columns in submitted dataset removed and included in metadata such as publication information.
converted lat/lon from degrees decimal minutes to decimal degrees.
added underscores in some text fields
removed units from data colums. Units can be found in the parameters section.

CellSorting.csv