Specimen collection and DNA extraction

A total of 1,153 specimens were collected from 15 geographic regions for E. coruscans, 1,064 specimens from 11 regions for E. carbunculus, and 590 specimens from 16 regions for E. sp. Some of these specimens were used in two previous population genetic studies, as described below in the sections on mitochondrial DNA sequencing and microsatellite genotyping (Andrews et al. 2014; Andrews et al. 2016); in one of these studies, E. carbunculus was called Etelis marshi (Andrews et al. 2014) due to nomenclatural confusion and the existence of the cryptic species E. sp. (Andrews et al. 2016). Tissue specimens consisted of fin clips or muscle tissue collected by commercial fishers, purchased in fish markets, or collected on research cruises, and stored in salt-saturated DMSO buffer (Seutin et al. 1991). Within the Hawaiian Archipelago, specimens were collected between 1997 and 2012. For all other locations, specimens were collected between 2004 and 2012. Genomic DNA extractions were conducted using a phenol chloroform method (Cummings & Thorgaard 1994), DNeasy extraction kits (Qiagen, Valencia, CA, USA), or the Hotshot method (Meeker et al. 2007).

Mitochondrial DNA sequencing

We used cytochrome b (cytb) sequence data from two previous studies for E. coruscans and E. carbunculus collected throughout the Hawaiian Archipelago (Andrews et al. 2014), and for E. carbunculus and E. sp. collected from 13 additional regions in the Indo-Pacific (Andrews et al. 2016). In this study, we also generated cytb sequence data for E. coruscans specimens collected from 11 additional regions in the Indo-Pacific. PCR conditions and DNA sequencing methods were consistent across all studies. For E. coruscans, a 560bp fragment was amplified using the primers Cyb-05 L15020 (GCCAACGGCGCATCCTTCTTCTT; Meyer 1993) and Cyb-07 H15573 (AATAGGAAGTATCATTCGGGTTTGATG; Taberlet et al. 1992). For E. carbunculus and E. sp., a 524bp fragment was amplified using the primers EhucybF (TCAGTCGCACACATCTGCCG) and EhucybR (AGTGCAACAAGGACGGCTGC), both from Andrews et al. (2014); this region overlaps the region amplified for E. coruscans. PCR products were sequenced in one direction using an ABI 3730 automated DNA sequencer (Applied Biosystems, Foster City, CA), and sequences were edited and aligned using GENEIOUS PRO 5.6.2 (Biomatters, LTD, Auckland, NZ).

Microsatellite genotyping

We used microsatellite data obtained from the study of Andrews et al. (2014) for E. coruscans and E. carbunculus specimens collected throughout the Hawaiian Archipelago. We also generated microsatellite data from 10 additional Indo-Pacific locations for E. coruscans and three additional Indo-Pacific locations for E. carbunculus. Microsatellite PCR and genotyping protocols followed those described in Andrews et al. (2014), and were conducted by the same person as in the previous study for each species. A total of 10 microsatellite loci were analyzed for E. coruscans and 11 microsatellite loci for E. carbunculus. PCR products were analyzed on ABI 3730XL or ABI 3130XL genetic analyzers, with all fragments from each primer set run on one machine to avoid bias in fragment length estimates across sequencers. Fragments were scored using GENEMAPPER 4.0 (Applied Biosystems).

GENALEX 6.5 (Peakall & Smouse 2006) was used to identify specimens with identical microsatellite genotypes to determine whether any individual fish were represented more than once in the dataset. Each microsatellite locus was tested for deviations from Hardy Weinberg Equilibrium (HWE) and linkage equilibrium using ARLEQUIN 3.5.2.2 (Excoffier et al. 2005) for all locations outside of the Hawaiian Archipelago with n>10. Tests for deviation from HWE and linkage equilibrium for the samples from the Hawaiian Archipelago were reported in Andrews et al. (2014). Bayesian clustering analyses (described below) were also conducted removing one locus at a time to investigate the influence of each locus on the results.

For a description of the population structure and demographic history analyses using these data see Andrews et al. (2020).

Species List:

ScientificName,AphiaID,LSID

Etelis carbunculus,212545,urn:lsid:marinespecies.org:taxname:212545

Etelis coruscans,212544,urn:lsid:marinespecies.org:taxname:212544

etelis_microsats.csv