Table of Contents

• Coverage
• Dataset Description
  • Methods & Sampling
  • Data Processing Description
• Data Files
• Related Publications
• Related Datasets
• Parameters
• Instruments
• Project Information
• Program Information
• Funding

Specimen collection and DNA extraction

A total of 1,153 specimens were collected from 15 geographic regions for E. coruscans, 1,064 specimens from 11 regions for E. carbunculus, and 590 specimens from 16 regions for E. sp. Some of these specimens were used in two previous population genetic studies, as described below in the sections on mitochondrial DNA sequencing and microsatellite genotyping (Andrews et al. 2014; Andrews et al. 2016); in one of these studies, E. carbunculus was called Etelis marshi (Andrews et al. 2014) due to nomenclatural confusion and the existence of the cryptic species E. sp. (Andrews et al. 2016).  Tissue specimens consisted of fin clips or muscle tissue collected by commercial fishers, purchased in fish markets, or collected on research cruises, and stored in salt-saturated DMSO buffer (Seutin et al. 1991). Within the Hawaiian Archipelago, specimens were collected between 1997 and 2012. For all other locations, specimens were collected between 2004 and 2012. Genomic DNA extractions were conducted using a phenol chloroform method (Cummings & Thorgaard 1994), DNeasy extraction kits (Qiagen, Valencia, CA, USA), or the Hotshot method (Meeker et al. 2007).

Mitochondrial DNA sequencing

We used cytochrome b (cytb) sequence data from two previous studies for E. coruscans and E. carbunculus collected throughout the Hawaiian Archipelago (Andrews et al. 2014), and for E. carbunculus and E. sp. collected from 13 additional regions in the Indo-Pacific (Andrews et al. 2016). In this study, we also generated cytb sequence data for E. coruscans specimens collected from 11 additional regions in the Indo-Pacific. PCR conditions and DNA sequencing methods were consistent across all studies. For E. coruscans, a 560bp fragment was amplified using the primers Cyb-05 L15020 (GCCAACGGCGCATCCTTCTTCTT; Meyer 1993) and Cyb-07 H15573 (AATAGGAAGTATCATTCGGGTTTGATG; Taberlet et al. 1992). For E. carbunculus and E. sp., a 524bp fragment was amplified using the primers EhucybF (TCAGTCGCACACATCTGCCG) and EhucybR (AGTGCAACAAGGACGGCTGC), both from Andrews et al. (2014); this region overlaps the region amplified for E. coruscans. PCR products were sequenced in one direction using an ABI 3730 automated DNA sequencer (Applied Biosystems, Foster City, CA), and sequences were edited and aligned using GENEIOUS PRO 5.6.2 (Biomatters, LTD, Auckland, NZ).

Microsatellite genotyping

We used microsatellite data obtained from the study of Andrews et al. (2014) for E. coruscans and E. carbunculus specimens collected throughout the Hawaiian Archipelago. We also generated microsatellite data from 10 additional Indo-Pacific locations for E. coruscans and three additional Indo-Pacific locations for E. carbunculus. Microsatellite PCR and genotyping protocols followed those described in Andrews et al. (2014), and were conducted by the same person as in the previous study for each species. A total of 10 microsatellite loci were analyzed for E. coruscans and 11 microsatellite loci for E. carbunculus. PCR products were analyzed on ABI 3730XL or ABI 3130XL genetic analyzers, with all fragments from each primer set run on one machine to avoid bias in fragment length estimates across sequencers. Fragments were scored using GENEMAPPER 4.0 (Applied Biosystems).

GENALEX 6.5 (Peakall & Smouse 2006) was used to identify specimens with identical microsatellite genotypes to determine whether any individual fish were represented more than once in the dataset. Each microsatellite locus was tested for deviations from Hardy Weinberg Equilibrium (HWE) and linkage equilibrium using ARLEQUIN 3.5.2.2 (Excoffier et al. 2005) for all locations outside of the Hawaiian Archipelago with n>10. Tests for deviation from HWE and linkage equilibrium for the samples from the Hawaiian Archipelago were reported in Andrews et al. (2014). Bayesian clustering analyses (described below) were also conducted removing one locus at a time to investigate the influence of each locus on the results.

For a description of the population structure and demographic history analyses using these data see Andrews et al. (2020).

Species List:

BCO-DMO Data Manager Processing Notes:
* The region is known ("Indo-Pacific").  Bounding box coordinates were calculated in python using the multipolygon from marineregions.org ( MRID: 14289).
* Corrected column alignment caused by the locations with multiple words parsed into separate columns which pushed allele columns to the right.  Used version Brian Bowen submitted on 2022-03-22.
* Sheet 1 in two excel files imported into the BCO-DMO Data system (Microsats_Ecoruscans_columns_realigned.xlsx, Microsats_Ecarbunculus_columns_realigned.xlsx) and tables combined
* Table transformed (unpivoted) from two columns per locus containing the first and last allele IDs, to one column for Locus_Name, Allele1_ID, and Allele2_ID.

Project summary:
This research is designed to resolve the origins of Hawaiian reef fishes. All living inhabitants of the Hawaiian archipelago necessarily originate elsewhere, due to the volcanic history of the island arc. Hawaii also has the highest endemism (native species) in the Pacific, with 25% of the 625 near-shore fish species found nowhere else. Where did these fishes come from? Two prominent hypotheses regarding the origins of Hawaiian marine species maintain that colonists arrive either from the south (via the Line Islands and Johnston Atoll) or from the west (via Japan). Previous research has shown that Hawaiian endemic limpets (genus Cellana) colonized from Japan (Bird et al. 2011 Mol. Ecol. 20:2128 – 2141). Andrews et al. (2014; PLoS One 9: e91665) report evidence for a colonization pathway from the south (Johnston Atoll) to the middle of the archipelago in the Papahanaumokuakea Marine National Monument (PMNM). In this project, we will sample locations to the south of Hawaii (Johnston and Line Islands) and to the west of Hawaii (Ogasawara and Ryukyu Islands) for a suite of 20 reef fishes in order to resolve the origins of Hawaiian biodiversity.  Advanced rebreather technology allows dives with longer bottom time and more efficient sample collection, and our program is pioneering the applications of this advance diving technology. To test alternate hypotheses in the lab, we will employ both population genetics (shifts in genotype frequencies) and phylogenetics (DNA sequence divergence) for more ancient separations. Restriction-digest associated DNA sequencing (RAD-seq) is the best method for studies of phylogeography, phylogenetics, and population biology because it provides high coverage of homologous portions of the genome from multiple individuals for comparatively low cost and effort. We use the ezRAD approach developed in the shared Bowen-Toonen Lab.

Description from NSF award abstract:
The Hawaiian Islands are the product of a volcanic hot spot in the middle of the North Pacific. Hence every living thing on this isolated archipelago has origins elsewhere. This project will investigate the origins of Hawaiian reef fishes, which are important both as a food source and a cultural touchstone in native Hawaiian communities. Two prominent hypotheses maintain that marine fish originally arrived from the south (Line Islands and Johnston Atoll) or from the west (Japan). To test these hypotheses, this research will augment existing specimens from Hawaii with expeditions to Johnston Atoll (closest shallow habitat to the south), the northern Line Islands (Palmyra), southern Line Islands (Christmas Island), and Ryukyu Islands and Ogasawara Islands in Japan. Advanced genetic techniques will be used to resolve the closest relatives to the Hawaiian fish species and the pathways by which reef species colonize Hawaii and help establish patterns of biodiversity. In cases where Hawaiian species are closely related to widespread sister species, this project will detect hotspots of genetic divergence. Because this research will reveal the sources of Hawaiian marine biodiversity, results can be used to help define priorities for reef protection. The project will support two graduate students and train at least two more in all aspects of the project from rebreather diving, specimen collection and curation, information management, and advanced genetic techniques. There will be outreach efforts to schools through existing programs, and expedition teams will include a videographer to provide footage for the award-winning Voice of the Sea program, broadcast locally. Expeditions will also include an outreach specialist to handle media reports and promote awareness and concern for reefs in the communities surrounding study sites. 

The investigators will sample a suite of 20 reef fishes at locations to the south (Johnston and Line Islands) and west (Ogasawara and Ryukyu Islands) of Hawaii to resolve the origins of Hawaiian biodiversity. The investigators will employ both population genetics (shifts in genotype frequencies) and phylogenetics (DNA sequence divergence) for more ancient separations to test their hypotheses. Restriction-digest associated DNA sequencing (RAD-seq) will be employed for the phylogeography, phylogenetics, and population biology studies because it provides high coverage of homologous portions of the genome from multiple individuals for comparatively low cost and effort.

Description from NSF award abstract:
The objective of this Research Coordination Network project is to develop an international network of researchers who use genetic methodologies to study the ecology and evolution of marine organisms in the Indo-Pacific to share data, ideas and methods. The tropical Indian and Pacific Oceans encompass the largest biogeographic region on the planet, the Indo-Pacific. It spans over half of the Earth's circumference and includes the exclusive economic zones of over 50 nations and territories. The Indo-Pacific is also home to our world's most diverse marine environments. The enormity and diversity of the Indo-Pacific poses tremendous logistical, political and financial obstacles to individual researchers and laboratories attempting to study the marine biology of the region. Genetic methods can provide invaluable information for our understanding of processes ranging from individual dispersal to the composition and assembly of entire marine communities.

The project will:
(1) assemble a unique, open access database of population genetic data and associated metadata that is compatible with the developing genomic and biological diversity standards for data archiving,
(2) facilitate open communication and collaboration among researchers from across the region through international workshops, virtual communication and a collaborative website,
(3) promote training in the use of genetic methodologies in ecology and evolution for researchers from developing countries through these same venues, and
(4) use the assembled database to address fundamental questions about the evolution of species and the reservoirs of genetic diversity in the Indo-Pacific.

The network will provide a model for international collaborative networks and genetic databasing in biodiversity research that extends beyond the results of this Research Coordination Network effort.