Table of Contents

• Coverage
• Dataset Description
  • Methods & Sampling
  • Data Processing Description
• Data Files
• Supplemental Files
• Related Publications
• Related Datasets
• Parameters
• Instruments
• Project Information
• Funding

Water samples were collected monthly or bimonthly (September 2019 to October 2020) at the Martha's Vineyard Coastal Observatory (MVCO) from about 2 meters below the surface using bucket casts or a CTD deployed from R/V Tioga. Samples were transferred to a carboy in a cooler for transport back to the laboratory. Water was processed within 2 hours of collection. One liter of whole seawater was collected onto 47-millimeter (mm) 0.2-micrometer (µm) Millpore Isopore filters and stored at -20 degrees Celsius (°C) for DNA extraction and amplicon sequencing. Nucleic acids were extracted from half of a 47mm filter that was cut into small pieces using scissors and cleaned with alcohol in between samples. The lysis method followed a hot detergent plus bead disruption protocol (Gast et al., 2004). Filter pieces were placed in a sterile 2-milliliter (ml) microfuge tube and 2 x lysis buffer was added, along with approximately 50 microliters (µl) of beads. The tubes were vortexed for 30 seconds and then placed at 65°C for 5 minutes, followed by two cycles of vortex and heat incubation. Sodium chloride and CTAB were added, and the samples were incubated at 70°C for 10 minutes. Following extraction with an equal volume of chloroform, the aqueous phase was removed and precipitated overnight at -20°C with 0.6 volume of isopropanol. The recovered DNA pellet was resuspended in 20 µl of sterile water.

Amplification of the V4 region of the 18S ribosomal RNA gene was accomplished using the primers 574V4F (5’ [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5’ [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5’ adapter sequences (indicated by square brackets). PCR reactions were performed in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq DNA polymerase, 2 millimoles (mM) MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95°C for 5 minutes; 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 90 seconds; 72°C for 5 minutes; 4°C hold. No template negative controls were included. Each sample reaction was examined to confirm the correct product size of approximately 500 base pairs (bp). Triplicate reactions were pooled and sent to the RI-INBRE Molecular Informatics Core for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing.

Amplicon data collected in this work was combined with other MVCO time series amplicon data to examine the temporal variation in Syndiniales types. The prior sequencing effort covered samples collected between 2013-2019 and 2020-2021, and used the same primer set reported here. Trimmed and demultiplexed raw reads were imported into qiime2 and the forward reads were analyzed for high quality (Q value 30 over 90% of read), removal of chimeric sequences, identification of amplicon sequence variants (ASVs) at 100% similarity, removal of ASVs that occurred in fewer than 2 samples, and assignment of taxonomy using PR2 database.

Data Processing:
qiime2 was used to process the amplicon sequence data.

Demultiplex

qiime tools import --type ‘SampleData[PairedEndSequencesWithQuality]’ --input-path <manifest file name> --output-path <name.qza> --input-format PairedEndFastqManifestPhred33V2

qiime tools import --type ‘SampleData[SequencesWithQuality]’ --input-path <manifest file name> --output-path <name.qza> --input-format SingleEndFastqManifestPhred33V2

To evaluate the sequences qiime demux summarize --i-data name.qza --o-visualization name.qzv

Denoise, dereplicate, quality filter & remove chimeras

qiime dada2 denoise-single --i-demultiplexed-seqs <.qza file from above> --p-trim-left 10 --p-trunc-len 290 --p-chimera-method pooled --o-table <name.qza> --o-representative-sequences <name.qza> --o-denoising-stats <name.qza>

Remove singletons

qiime feature-table filter-features --i-table <name of table generated in prior step> --p-min-frequency 2 --o-filtered-table <new table name .qza>

qiime feature-table filter-seqs --i-data <name of rep seq file created in prior step> --i-table <name of filtered table> --o-filtered-data <new repseq file .qza>

Cluster sequences based upon identity

qiime vsearch cluster-features-de-novo --i-table <name.qza> (filtered table) --i-sequences <name.qza> (filtered rep-seqs file) --p-perc-identity 1.0 --o-clustered-table <name.qza> (this is a biom table that has abundances of each cluster) --o-clustered-sequences <name.qza> (this is a new rep-set of sequences - your ASVs)

Assign taxonomy

qiime feature-classifier classify-consensus-vsearch --i-query <name.qza> (this is the rep-set of sequences just created by cluster) --i-reference-reads pr2_4.12.0_18S.qza (this is the PR2 reference set of sequences) --i-reference-taxonomy pr2_4.12.0_18S_tax.qza (this is the corresponding PR2 taxonomy) --p-maxaccepts 1 --o-classification <name.qza> (this is your rep-set sequences and their taxonomy)

BCO-DMO Processing:
- added columns for the latitude and longitude of the sampling locations;
- converted the date field to YYYY-MM-DD format.

NSF Award Abstract:
The ecological importance of parasitic dinoflagellates has been recognized for some time, particularly during epidemic outbreaks that cause mass mortality of their hosts, damage to aquaculture, and render commercially valuable Crustacea unpalatable. The dominate parasitic dinoflagellate group found in international global ocean surveys is referred to as MALV II Syndiniales. In the planktonic environment, the MALV II Syndiniales group not only exerts top-down controls on their prey populations, but based on their apparent ubiquity and abundance, they likely shape the pools of nutrients in marine water columns. Data on cultured samples reveals this hyper-diverse group can infect a wide range of protist hosts, as well as copepods, and fish larvae. Gaps in knowledge of the specificity and dynamics of the host-parasite interactions contribute to difficulties in estimating the impacts on the coastal ecosystems. In this project, researchers combine novel methods in microscopy, genomics, and chemistry to track host-parasite dynamics at a coastal site over an annual cycle followed by modeling to assess the impacts on microbial ecosystem dynamics. The researchers will engage undergraduate and high school students in field and laboratory research activities. In addition, support for a graduate student is included along with plans to disseminate the research results more broadly through publications and presentations.

Syndiniales parasitism is a widespread, albeit under-studied symbiotic interaction in the marine environment and little is known about regulation of protist populations by these parasites. In spite of their cosmopolitan distribution in the global ocean and their apparent abundance in molecular datasets of protist marker genes, little is known about the ecology of these parasites and almost no genomic data exists for them. In this project, the researchers combine high-resolution sampling, water chemistry (including nutrients) analyses, molecular marker gene analyses, fluorescence in situ hybridization, single cell genomics, and modeling to produce the first focused assessment of host-MALVII parasite dynamics and ecology at the community level in a coastal marine ecosystem. The researchers will evaluate temporal dynamics of host and parasite diversity and will examine temporal variation in levels of infection of the protist community and host-parasite specificity using high-resolution sampling in Salt Pond, Falmouth, MA, and in situ hybridization microscopy. Molecular approaches include amplicon tag high throughput sequencing, leveraging the emerging third generation sequencing technology, Oxford Nanopore's MinION to elucidate host-parasite identities. The researchers will also apply advances in single-cell genome sequencing to inform on strain-specific genome content, including the molecular mechanisms underpinning protist parasitism. Contributions to pools of particulate and dissolved organic matter will be estimated for several of the most commonly infected host taxa in Salt Pond using laboratory experiments, providing the first set of values for modeling impacts of Syndiniales parasitism on pools of organic and inorganic nutrients.

This award reflects NSF's statutory mission and has been deemed worthy of support through evaluation using the Foundation's intellectual merit and broader impacts review criteria.