Table of Contents

• Coverage
• Dataset Description
  • Methods & Sampling
  • Data Processing Description
  • BCO-DMO Processing Description
  • Problem Description
• Related Publications
• Related Datasets
• Parameters
• Instruments
• Deployments
• Project Information
• Funding

The raw sequence data are available through the National Center for Biotechnology Information (NCBI):
RNA-Seq data: BioProjects: PRJNA324453, PRJNA662858, PRJNA496596, PRJNA807352
* Supplemental file "954181_v1_sra-run-table.csv" for SRA accession and BioSample collection information for the four bioprojects.

Collections and sample preservation

Collections during the spring and fall were made during oceanographic cruises of the Seward Line Long-term Observation Program (LTOP) and northern Gulf of Alaska Long Term Ecological Research programs (https://nga.lternet.edu/) between 2015 and 2022. Additional samples were collected at nearshore stations (GAK1 and RES2.5) in 2019 and 2023, and in 2019 in the Gulf of Alaska Seamount region from below 1000 m (see Block (2024) for more information about sampling).

RNA-Seq Data

Pre-adult Neocalanus flemingeri stage CV were collected from the upper 100 m in April and May from 5 to 6 stations. Upon retrieval of the net (QuadNet, 53 µm mesh), the plankton collection was live sorted under the microscope and preserved in RNALater. In 2019, N. flemingeri were collected in mid-April for an incubation experiment with individuals maintained in the laboratory for up to 2 months before preservation for RNA-Seq (Roncalli et al., 2023). In September, samples were collected from depth (300 to 700 m) using a 0.25 m² Multinet (Hydrobios), live sorted and preserved for RNA-Seq immediately or after laboratory incubation. Fall collections were primarily from Prince William Sound (stations PWS2 and KIP2) with the exception of July 2019, when adult females were collected from depth (>1000 m) in the Gulf of Alaska (stations GAK19 and “Quinn deep”).

Sample processing (RNA extraction, library preparation and high-throughput sequencing) has been described previously (Roncalli et al., 2018, 2019, 2021). Paired-end sequencing was done on the Illumina Platform (NextSeq) and short-sequence read lengths were set to either 75 or 150 bp with sequencing depth of 10M or greater. Raw sequence data are available through National Center for Biotechnology Information with additional metadata available through BCO-DMO datasets ids 922330 and 914459 (Lenz et al., 2024). Raw sequence data were quality checked, sequences with phred scores below 30 were removed, and sequences were trimmed to remove adapters and the first 9 bp (Roncalli et al., 2018). In addition, rRNA transcripts were removed using SortMeRNA (version 4.2.0) (Kopylova et al., 2012). Lineage identification was based on cytochrome c oxidase subunit-1 (mtCOI) reference sequences that were used to establish the sequence differences between the two forms (Machida and Tsuda, 2010). For the RNA-Seq data, a mtCOI reference database was generated using full length sequences for small-form and large-form  N. flemingeri, as well as N. plumchrus, N. cristatus, Calanus marshallae, Eucalanus bungii and Metridia pacific (see Supplemental File "species_list_copepods.csv" for additional copepod species name information and taxonomic identifiers). The reference consisted of consensus sequences obtained by comparing sequences downloaded from NCBI and from de novo assemblies (Hartline et al., 2023; Hartline et al., 2024 [BCO-DMO dataset 908689] ). RNA-Seq libraries from each individual were mapped against the mtCOI reference using Bowtie2 (version 2.3.5.1, default options in paired end mode) as described previously for an approach that was originally developed to identify and quantify Calanus congeners in RNA-Seq data (Lenz et al., 2021a,b). Since mtCOI mapping is highly specific, this approach successfully distinguishes between closely related species and genetic lineages.  Cross-mapping is minimal, and even between the two N. flemingeri lineages is typically below 2% (maximum 7%). Data analysis involved tallying the number of individuals that mapped to each lineage for each station/year collection. Analysis for spatial and temporal patterns of the number of small vs large form individuals was done by combining data by year from multiple locations, and by combining regional data for both pre-adult and adult individuals to examine interannual differences.

DNA Sequencing

In 2016, additional individuals were collected during the spring and fall cruises for DNA extraction (n=123), amplification of the mtCOI and Sanger sequencing. Individual N. flemingeri were preserved in RNALater prior to DNA extraction using the DNEasy Blood and Tissue Kit (Qiagen). Extracted DNA was amplified using universal DNA primers, LCO1490 and HCO2198, which consistently amplify a 710-bp region of the mitochondrial cytochrome oxidase subunit I gene from a variety of metazoan invertebrates (Folmer et al, 1994). PCR products were checked for expected size using gel electrophoresis, and purified using Qiagen`s Purification Kit prior to Sanger sequencing at the Advanced Studies in Genomics, Proteomics and Bioinformatics (ASGPB) at the University of Hawai‘i at Mānoa. Sequence data were edited for quality using Geneious and searched on NCBI for the closest match using BLAST (Altschul et al., 1990). Top N. flemingeri hits were compared to published lineage-specific sequences (Machida and Tsuda, 2010) for small form vs. large form identification.

Metabarcoding

DNA metabarcoding of bulk samples containing nauplii of N. flemingeri were collected in Resurrection Bay between January and March, 2023, size fractionated and preserved in ethanol (Block, 2024). The small size-fraction of the bulk samples (53 – 210 µm fraction) were extracted for DNA using the Qiagen DNeasy Blood and Tissue Mini Kit with an extended 24-hour proteinase K incubation to ensure adequate lysis. The mtCOI was amplified using the mlCOIintF and jgHCO2198 primers (Leray et al., 2013), sequenced and processed using established pipelines as described elsewhere (Block, 2024). Amplicon sequences were quantified, clustered and identified to lineage using reference sequences downloaded from the MetaZooGene database (Bucklin et al., 2021). The two N. flemingeri genetic lineages were represented by two distinct operational taxonomic units (OTUs) that differed by ca. 3%. 10 diagnostic base pairs out of 307 are indicated by the highlighting in the fasta sequences:

>Nf1_Neocalanus flemingeri OTU 1 (small form)

GTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCATTT

AGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGAACCCTCGGAAACTTACG

AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC

TGTTCTCCTTCTCCTGTCTTTACCAGTATTAGCTGGAGCTATTACAATATTGTTAACAGA

TCGTAACCTAAATACTTCTTTTTATGATGTTGGCGGGGGCGGTGACCCTATTCTGTACCA

GCATCTA

>Nf2_Neocalanus flemingeri OTU2 (large form)

CTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCACTT

GGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGGACCCTGGGAAACTTGCG

AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC

TGTTCTCCTTCTCCTGTCTTTACCGGTATTAGCTGGAGCTATTACAATATTGTTAACAGA

TCGTAACCTAAATACTTCTTTCTATGATGTTGGGGGGGGCGGTGACCCTATTCTATACCA

GCATCTA

The proportion of the two lineages was estimated from the relative counts of each OTU.

Cruise identifiers and Sampling dates:
This list includes cruise identifiers also entered in the "Deployments" section of this metadata page as well as description of additional small boat deployments without formal cruise identifiers.

TXS15, Russell Hopcroft, 5/10/15 - 5/11/15
TXF15, Russell Hopcroft, 9/13/15 - 9/20/15
TXS16, Russell Hopcroft, 4/29/16 - 5/6/16
TXS16, Russell Hopcroft, 4/29/16 – 5/2/16; 5/25/16 - 5/27/16
TXF16, Russell Hopcroft, 9/15/16 - 9/20/16
TXS17, Russell Hopcroft, 5/3/17 - 5/9/17
TXF17, Russell Hopcroft, 9/15/17 - 9/22/17
SKQ201810S, Russell Hopcroft, 4/17/18 - 5/6/18
TGX201809, Russell Hopcroft, 9/11/18 - 9/25/18
TGX201904, Russell Hopcroft, 4/26/19 - 5/9/19
SKQ201916S, Russell Hopcroft, 7/21/19 – 8/3/19
TGX201909, Russell Hopcroft, 9/10/19 - 9/26/19
SKQ202006S, Russell Hopcroft, 5/3/20 -5/10/20
SKQ202106S, Russell Hopcroft, 4/19/21 -5/7/21
TGX202109, Russell Hopcroft, 9/10/21 - 9/27/21
SKQ202207S, Ana Aguilar Islas, 4/19/22 - 5/8/22
Day-trips aboard the M/V Dora 4/15/2019 to GAK1 and the R/V Nanuq in Resurrection Bay, AK between January and March, 2023
NOAA Ocean Exploration, Gulf of Alaska Seamounts 2019, Russell Hopcroft, 7/21/2019 – 8/3/2019

The presence and relative occurrence of the two genetic variants were based on differences in the cytochrome c oxidase subunit-1 sequence (mtCOI) (Machida & Tsuda 2010, Lenz et al. 2021). A mtCOI reference database was generated from the unique sequences for the two variants as well as from those of other common copepod species from the Gulf of Alaska (Hartline et al. 2023). To distinguish between the genetic variants, short-read RNA-Seq data from live-sorted N. flemingeri were mapped against this mtCOI reference (Bowtie2, vs. 2.3.5.1). The variant (or species) receiving the most mapped reads, usually in great excess, was taken as the individual's identity. This was also used to identify and remove individuals that had been misidentified in the original morphological-based sorting.

* Submitted files were imported into the BCO-DMO data system for this dataset:
CopepodSpeciesFilter.csv (will appear in this dataset as Data File: 954181_v1_copepod_species_filter.csv)
Bowtie-Mapping results.csv (will appear in this dataset as Data File: 954181_v1_bowtie-mapping-results.csv)
Suitos-BLAST-data.csv (will appear in this dataset as Data File: 954181_v1_suitos-blast-data.csv)
* The data submitter will be consulted if one of these three tables should be considered the primary table of the dataset, and if so, will be imported into our secondary data system (ERDDAP) and additional file formats will be shown for download options for that table.

* Column names adjusted to conform to BCO-DMO naming conventions designed to support broad re-use by a variety of research tools and scripting languages. [Only numbers, letters, and underscores.  Can not start with a number]

* Non-standard whitespace characters replaced with standard space character.
* Did not replace instances of Ü in data from "CopepodSpeciesFilter.csv" but brought that to the attention of the data submitter in case a it should be removed.

* Unique species names extracted from "CopepodSpeciesFilter.csv" and matched to identifiers at World Register of Marine Species (WoRMS, marinespecies.org on 2025-02-27). ScientificName and Life Science Identifer (LSID) column added for the identifiers for the species names used within "Species" categories in this table. Supplemental file for copepod species list added.

* Additional supplemental file added with combined information from all SRA Run tables from all three associated NCBI BioProjects which includes SRA run, experiment, and BioSample collection metadata. This was added as Supplemental File: 954181_v1_sra-run-table.csv

* lat_lon field split into lat, lon columns and standardized to decimal degree format for geospatial research-ready capability. No lat_lon was provided for samples in BioProject PRJNA496596, PRJNA807352, PRJNA662858, and some were missing in PRJNA324453.

* Several columns in sra_run table were not able to be typed as numerc such as depth (due to some being ranges in single value) and temp which included String units in the values.

* Citation in metadata on this dataset "(see map, SupplementS2)" was replaced with "(see Block (2024) for more information about sampling)" since this graphic was not provided and is not in the referenced results paper (Block, 2024) as Supplement S2. It may be Figure 1 of Block (2024).
* Invalid sampling date in metadata text "TXS15, Russell Hopcroft, 5/103/15 - 5/11/15" changed to "5/10/15 - 5/11/15" as cruise dates were only between "05-05-2015 to 05-11-2015"

NSF Award Abstract
Global climate change and associated extreme weather events are increasingly impacting marine communities at all trophic levels and leading to shifts in the timing of life history events. This project is investigating the annual restart of the spring zooplankton community in the Gulf of Alaska in order to determine the timing of species-specific recruitment and growth. Zooplankton are small pelagic animals that are a critical link between microalgae and protozoans and higher levels in the food web including economically important fishes, birds and marine mammals. While their abundances and species composition have been documented over part of the annual cycle between late spring and fall, this project focuses on winter and early spring. The project integrates traditional methods with modern molecular approaches to characterize the diversity, development, feeding and physiology of zooplankton, especially the early developmental stages of copepods (small crustaceans). The goal is to determine which species are there, how many are present and where they are in the water column, and to reveal indicators of their health. Broader impacts include research training for three graduate students and at least four undergraduates in biological oceanography and physiological ecology. Outreach activities are focusing on broadening the public’s understanding of plankton ecology. An illustrated zooplankton guide for the Gulf of Alaska and plankton module for school teachers and students is being produced in collaboration with the Center for Alaskan Coastal Studies. Other plans include sponsorship of nature-drawing workshops on zooplankton and the production of an Art & Science traveling exhibit.

This project is tracking zooplankton population abundances, species composition and developmental stages through the spring restart in a high-latitude fjord in the northern Gulf of Alaska. While the entire zooplankton community is being characterized, the main focus is on the difficult-to-assess early developmental stages of copepods, which dominate the late spring biomass in the region. Three central hypotheses guide the research: 1) high abundances of copepod nauplii are present before any measurable increases in food in surface waters; 2) species diversity increases between winter and spring, with nauplii from large lipid-rich capital-breeding species appearing first, followed by those from income- and hybrid-strategy species and finally nauplii that emerge from dormant eggs; 3) prior to the appearance of food resources, nauplii from capital-breeding species conserve resources by delaying development and entering a state of dormancy in the second and third naupliar stages. The project entails intensive depth-stratified field sampling to characterize the wild community, in combination with laboratory experiments on nauplii to determine their responsiveness to food. The prey are being characterized by measuring chlorophyll a, dietary and prey community DNA sequencing and flow cytometry to establish diversity and abundances. Size-fractionated zooplankton samples are being analyzed using microscopy and community DNA sequencing to ascertain species diversity, developmental stage distribution and abundances. Feeding activity is being measured using dietary DNA sequencing of nauplii followed by comparisons with the prey field. Dormancy in nauplii is being determined by differential gene expression of target genes (RT-qPCR) and high-throughput sequencing of mRNA of individuals (transcriptomics) and community samples (meta-transcriptomics). Short-term and long-term effects of food availability on dormancy, development and growth are being quantified in laboratory experiments. Broader impacts are focused on training of students in interdisciplinary research and state-of-art techniques, and public outreach to introduce plankton ecology to broader audiences.